
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
grm3
- Ensembl ID:
- ENSDARG00000031712
- ZFIN ID:
- ZDB-GENE-061009-13
- Description:
- metabotropic glutamate receptor 3 [Source:RefSeq peptide;Acc:NP_001121815]
- Human Orthologue:
- GRM3
- Human Description:
- glutamate receptor, metabotropic 3 [Source:HGNC Symbol;Acc:4595]
- Mouse Orthologue:
- Grm3
- Mouse Description:
- glutamate receptor, metabotropic 3 Gene [Source:MGI Symbol;Acc:MGI:1351340]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36575 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa19195 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36575
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047309 | Nonsense | 347 | 884 | 2 | 5 |
ENSDART00000134224 | Nonsense | 347 | 884 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 8470624)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 9048002 GRCz11 18 9006021 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTACTTCCAGACCCTCACGCCCCAAATTAACCATCGCAACCCCTGGTTC[A/T]AAGACTTCTGGGAGCAAAAGTTTCAGTGTTCATTGGGTGGGACGTCAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19195
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047309 | Nonsense | 732 | 884 | 3 | 5 |
ENSDART00000134224 | Nonsense | 732 | 884 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 8447047)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 9024425 GRCz11 18 8982444 - KASP Assay ID:
- 2261-1868.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGGTACGCGGCGGTTCACCACGCCAGAGAAACGCCAGACTGTCATTTTG[A/T]AGTGCAATGTAAGGGACTCTAGCATGCTGATGTCGCTGAGCTACGATGTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Brachial circumference: Genome-wide association study to identify common variants associated with brachial circumference: a meta-analysis of 14 cohorts. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: