zgc:136639

Ensembl ID:
ENSDARG00000031709
ZFIN ID:
ZDB-GENE-060421-7142
Description:
hypothetical protein LOC678639 [Source:RefSeq peptide;Acc:NP_001035474]
Human Orthologue:
MLLT1
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 [Sour
Mouse Orthologue:
Mllt1
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 Gene

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39813 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099735 Nonsense 444 567 9 12
ENSDART00000125049   None 252 None 6

The following transcripts of ENSDARG00000031709 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22432075)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23318780
GRCz11 2 22974431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAATTTTTAATCCTTTAAGTTCATTCTGAATTTCCTGTTTTCAGTT[T/A]GAGCATGGACAGTGAGAGTGATGGTAACGAGGAGTCTCGTCCTCCCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link