zgc:113383

Ensembl ID:
ENSDARG00000031651
ZFIN IDs:
ZDB-GENE-050913-138, ZDB-GENE-050913-138
Description:
equilibrative nucleoside transporter 1 [Source:RefSeq peptide;Acc:NP_001025348]
Human Orthologue:
SLC29A1
Human Description:
solute carrier family 29 (nucleoside transporters), member 1 [Source:HGNC Symbol;Acc:11003]
Mouse Orthologue:
Slc29a1
Mouse Description:
solute carrier family 29 (nucleoside transporters), member 1 Gene [Source:MGI Symbol;Acc:MGI:1927073

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15811 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021925 Nonsense 159 440 6 13
ENSDART00000125208 Nonsense 159 440 5 13
Genomic Location (Zv9):
Chromosome 13 (position 47194668)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46570368
GRCz11 13 46860203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTGCAGGGCAGTCTGTTTGGTTTGGCAGGAATGCTGCCGGCGTCCTA[C/A]ACTACACCCATCATGAGYGGACAGGGCCTGGCTGGAGCRTTTGCRGCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link