stat2

Ensembl ID:
ENSDARG00000031647
ZFIN ID:
ZDB-GENE-080321-1
Human Orthologue:
STAT2
Human Description:
signal transducer and activator of transcription 2, 113kDa [Source:HGNC Symbol;Acc:11363]
Mouse Orthologue:
Stat2
Mouse Description:
signal transducer and activator of transcription 2 Gene [Source:MGI Symbol;Acc:MGI:103039]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20763 Essential Splice Site Available for shipment Available now
sa18208 Essential Splice Site Available for shipment Available now
sa20762 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050682 Essential Splice Site 183 835 5 23
Genomic Location (Zv9):
Chromosome 6 (position 39086251)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39157851
GRCz11 6 39155387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGCAGGATGAGTTTGATTTTAAGTATCAGACACTTCATATGGACTG[T/A]GAGGCTGCACACTTTATTTAAGTACACTGTCCTGTCATTTGTATGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050682 Essential Splice Site 312 835 9 23
Genomic Location (Zv9):
Chromosome 6 (position 39082078)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39153678
GRCz11 6 39151214
KASP Assay ID:
2259-7837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYAACTCTTTTGTCCTGAATGTATGCTTCATTAATTKCGTTTGTTTTTA[G/A]TGCATTCGTCGTAGAGACTCAGCCTTCAATGCCACAAGGACGAGGCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050682 Nonsense 793 835 23 23
Genomic Location (Zv9):
Chromosome 6 (position 39058292)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39129892
GRCz11 6 39127428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGCAGCATGGAACCATTCTGTTCTGACATTGATGTTAATAGGGCAT[T/A]GCAAGATTTCATAGACAGTTCAAACATCCTGAATAGCCCACCCTTTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association study in Han Chinese identifies three novel loci for human height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Psoriasis: Genome-wide scan reveals association of psoriasis with IL-23 and NF-kappaB pathways. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link