
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-119b12.6
- Ensembl ID:
- ENSDARG00000031506
- ZFIN ID:
- ZDB-GENE-041210-312
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RG90]
- Human Orthologue:
- FLVCR2
- Human Description:
- feline leukemia virus subgroup C cellular receptor family, member 2 [Source:HGNC Symbol;Acc:20105]
- Mouse Orthologue:
- Mfsd7c
- Mouse Description:
- major facilitator superfamily domain containing 7C Gene [Source:MGI Symbol;Acc:MGI:2384974]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15497 | Nonsense | Available for shipment | Available now |
sa12161 | Nonsense | Available for shipment | Available now |
sa18148 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15497
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000038696 | Nonsense | 309 | 495 | 4 | 11 |
ENSDART00000142092 | Nonsense | 277 | 465 | 4 | 9 |
ENSDART00000038696 | Nonsense | 309 | 495 | 4 | 11 |
ENSDART00000142092 | Nonsense | 277 | 465 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 46575703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 46420986 GRCz11 20 46324706 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTTYTATGCTGTCAGTACACTTCTCAACMGGATGATCATTGAACACTA[T/A]CCTGTAAGTCCCTCCCACTCATCAGCTATCCGGCCAATTATGAGAGCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12161
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000038696 | Nonsense | 309 | 495 | 4 | 11 |
ENSDART00000142092 | Nonsense | 277 | 465 | 4 | 9 |
ENSDART00000038696 | Nonsense | 309 | 495 | 4 | 11 |
ENSDART00000142092 | Nonsense | 277 | 465 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 46575703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 46420986 GRCz11 20 46324706 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTTYTATGCTGTCAGTACACTTCTCAACMGGATGATCATTGAACACTA[T/A]CCTGTAAGTCCCTCCCACTCATCAGCTATCCGGCCAATTATGAGAGCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18148
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000038696 | Nonsense | 469 | 495 | 9 | 11 |
ENSDART00000142092 | Nonsense | 437 | 465 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 46590648)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 46435931 GRCz11 20 46339651 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTATCTCAGGCTGTATAAAGTCAGATCTGCGCAGACAGCTGGCAAACCAG[C/T]AAGCACAAACTGCTGTAAGTATCAAAGTATCCAACCAGAAGGTCATGAAG
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: