si:ch211-286o21.1

Ensembl ID:
ENSDARG00000031461
ZFIN ID:
ZDB-GENE-090312-173
Description:
Novel protein similar to H.sapiens C10orf132, chromosome 10 open reading frame 132 (C10orf132) [Sour
Human Orthologue:
GOLGA7B
Human Description:
golgin A7 family, member B [Source:HGNC Symbol;Acc:31668]
Mouse Orthologue:
Golga7b
Mouse Description:
golgi autoantigen, golgin subfamily a, 7B Gene [Source:MGI Symbol;Acc:MGI:1918396]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45498 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039676 Essential Splice Site 60 214 1 5
ENSDART00000146456 Essential Splice Site 4 158 1 5
Genomic Location (Zv9):
Chromosome 13 (position 40860282)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39893354
GRCz11 13 40019244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCACCGGGACAGATCCTTCACCGTCTCAGGCATCATGGGGACAGAG[G/A]TAAGATCCACTAACCTTCATATGAGCTTCAAGCGAGATGAAAAGCGGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link