zgc:113343

Ensembl ID:
ENSDARG00000031455
ZFIN ID:
ZDB-GENE-050327-90
Description:
Zgc:113343 [Source:UniProtKB/TrEMBL;Acc:Q58EF6]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23836 Essential Splice Site Available for shipment Available now
sa16871 Essential Splice Site Available for shipment Available now
sa9874 Nonsense Available for shipment Available now
sa29494 Nonsense Mutation detected in F1 DNA During 2018
sa23837 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102724 Essential Splice Site None 356 1 4
ENSDART00000133663   None 141 None 4
ENSDART00000134898 Essential Splice Site None 229 1 3
Genomic Location (Zv9):
Chromosome 21 (position 2674818)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2197917
GRCz11 21 2223741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGAAACAGTTGTTGGTTATGCCCTCCCTATGCTGTTTTTATCTCACT[G/T]TAAGTACATTCACATTATTATTATTATTTATTAGGAGATATTTAAAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102724 Essential Splice Site 19 356 3 4
ENSDART00000133663 Essential Splice Site 19 141 3 4
ENSDART00000134898 Essential Splice Site 19 229 2 3
Genomic Location (Zv9):
Chromosome 21 (position 2676638)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2196097
GRCz11 21 2221921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGAAGAACCCKKCAGAATAAAGGAGGAAGAGACAGARGAACAAATAG[G/A]TTTGTGTTTATAGTCTTTCTTAWTARTGACTGAGTAAYATTAAGGGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102724 Nonsense 174 356 4 4
ENSDART00000133663   None 141 None 4
ENSDART00000134898 Nonsense 174 229 3 3
Genomic Location (Zv9):
Chromosome 21 (position 2677971)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2194764
GRCz11 21 2220588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCATTCAGCTGTGATCAGTGCAGYAAAGCATTTACATTAGAAAAATA[C/A]TTMAGACAACATCTTCATGTGCACGCTGCCGTGAAGCCCTACGTCTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102724 Nonsense 305 356 4 4
ENSDART00000133663   None 141 None 4
ENSDART00000134898   None 229 None 3
Genomic Location (Zv9):
Chromosome 21 (position 2678362)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2194373
GRCz11 21 2220197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACCGGAGGATTCACACTGGAGAGAAACCGTATCAGTGTTCACACTGT[G/T]GAAAGAGTTTCAATCGGACAGGAGGCCTGAAAGATCATCAGAAAGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102724 Nonsense 333 356 4 4
ENSDART00000133663   None 141 None 4
ENSDART00000134898   None 229 None 3
Genomic Location (Zv9):
Chromosome 21 (position 2678446)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2194289
GRCz11 21 2220113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATCAGAAAGTTCACACTGGGGAGAAACCACACCAGTGCTCCTCGTGT[G/T]GAAAGAGTTTCACTCAAATGTCTAATCTGCGGGTTCATATTGAAAAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link