zgc:56493

Ensembl ID:
ENSDARG00000031435
ZFIN ID:
ZDB-GENE-030131-8581
Description:
hypothetical protein LOC336637 [Source:RefSeq peptide;Acc:NP_956317]
Human Orthologues:
TXN, TXNDC2, TXNDC8
Human Descriptions:
thioredoxin domain containing 2 (spermatozoa) [Source:HGNC Symbol;Acc:16470]
thioredoxin domain containing 8 (spermatozoa) [Source:HGNC Symbol;Acc:31454]
thioredoxin [Source:HGNC Symbol;Acc:12435]
Mouse Orthologues:
Txn1, Txndc2, Txndc8
Mouse Descriptions:
thioredoxin 1 Gene [Source:MGI Symbol;Acc:MGI:98874]
thioredoxin domain containing 2 (spermatozoa) Gene [Source:MGI Symbol;Acc:MGI:2389312]
thioredoxin domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1914652]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9156 Nonsense Mutation detected in F1 DNA During 2018
sa4859 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa9156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045697 Nonsense 15 108 2 5

The following transcripts of ENSDARG00000031435 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40659066)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39548475
GRCz11 1 40266548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACTCAAATTYAACATTTGTGTTTATCAGGATGGCTTTRACAAAGCTT[T/A]GRCTGRGGCAGGTGATAAGCTGGTAGTGGTGGACTTCACAGCCACGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4859
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045697 Nonsense 101 108 5 5

The following transcripts of ENSDARG00000031435 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40662816)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39552225
GRCz11 1 40270298
KASP Assay ID:
554-3562.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTGTAGCTCGATGATTTCTCTGGGTCCAACCAGACTAAGCTGGAA[G/T]AGATGGTGAAACAACACAAAAACTGAGTCGGATATTACAAGTGTTTCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link