wt1a

Ensembl ID:
ENSDARG00000031420
ZFIN ID:
ZDB-GENE-980526-558
Description:
wilms tumor 1a [Source:RefSeq peptide;Acc:NP_571121]
Human Orthologues:
AL049692.1, WT1, WT1, WT1
Human Descriptions:
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:UniProtKB/TrEMBL;Acc:A0FJ58]
Mouse Orthologue:
Wt1
Mouse Description:
Wilms tumor 1 homolog Gene [Source:MGI Symbol;Acc:MGI:98968]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17769 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031499 Essential Splice Site 380 419 9 9
Genomic Location (Zv9):
Chromosome 25 (position 15535870)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15082414
GRCz11 25 15178814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCCTTCGATTCCAGTCTAATTTCCATCTCTCCTCTTTATCTCTCTC[A/C]GGTGAGAAGCCCTTCAACTGCAGATGGCCAAACTGTCAGAAGAAGTTYGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link