dctn2

Ensembl ID:
ENSDARG00000031388
ZFIN ID:
ZDB-GENE-040426-1279
Description:
Dynactin subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7T3H1]
Human Orthologue:
DCTN2
Human Description:
dynactin 2 (p50) [Source:HGNC Symbol;Acc:2712]
Mouse Orthologue:
Dctn2
Mouse Description:
dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45270 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042595   None 405 None 15
ENSDART00000103144 Essential Splice Site 36 406 3 14
ENSDART00000144842   None 402 None 15
Genomic Location (Zv9):
Chromosome 6 (position 58755394)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58858522
GRCz11 6 58852753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGGGTGTGCATGCGTGTGTTTATTCTGTGATTGGTTTATAACT[C/T]GTCCTGCAGGAGGAGCTGTGCAGTGACAGTGTGGAGCGCATCGTCGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link