arcn1l

Ensembl ID:
ENSDARG00000031214
ZFIN ID:
ZDB-GENE-040121-7
Description:
archain 1 like [Source:RefSeq peptide;Acc:NP_973722]
Human Orthologue:
ARCN1
Human Description:
archain 1 [Source:HGNC Symbol;Acc:649]
Mouse Orthologue:
Arcn1
Mouse Description:
archain 1 Gene [Source:MGI Symbol;Acc:MGI:2387591]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35850 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047902 Essential Splice Site 272 512 6 10
ENSDART00000131639   None 186 None 5
Genomic Location (Zv9):
Chromosome 15 (position 17054578)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18174951
GRCz11 15 18110973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAATGGCAATATTTTAGGCTTATGGTAGTTTATAAACTCTGTTTTCAA[G/A]TGTACATCTGAGGGTGGAGGAGAAGATCTCTCTAACCTGTGGTCGTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link