
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nr1d4a
- Ensembl ID:
- ENSDARG00000031161
- ZFIN ID:
- ZDB-GENE-080403-5
- Description:
- Novel protein similar to H.sapeins NR1D2, nuclear receptor subfamily 1, group D, member 2 (NR1D2) [S
- Human Orthologues:
- NR1D1, NR1D2
- Human Descriptions:
- nuclear receptor subfamily 1, group D, member 1 [Source:HGNC Symbol;Acc:7962]
- nuclear receptor subfamily 1, group D, member 2 [Source:HGNC Symbol;Acc:7963]
- Mouse Orthologues:
- Nr1d1, Nr1d2
- Mouse Descriptions:
- nuclear receptor subfamily 1, group D, member 1 Gene [Source:MGI Symbol;Acc:MGI:2444210]
- nuclear receptor subfamily 1, group D, member 2 Gene [Source:MGI Symbol;Acc:MGI:2449205]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44031 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31092 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1310 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44031
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103169 | Nonsense | 122 | 570 | 3 | 8 |
ENSDART00000103169 | Nonsense | 122 | 570 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 35861038)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 35710691 GRCz11 23 35809494 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGACGGGAGGCATGGTGCTCCTTTGTAAAGTATGTGGAGATATTGCAT[C/A]AGGGTTCCACTATGGTGTCCATGCATGTGAAGGCTGCAAGGTAAGACAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31092
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103169 | Nonsense | 122 | 570 | 3 | 8 |
ENSDART00000103169 | Nonsense | 122 | 570 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 35861038)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 35710691 GRCz11 23 35809494 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGACGGGAGGCATGGTGCTCCTTTGTAAAGTATGTGGAGATATTGCAT[C/A]AGGGTTCCACTATGGTGTCCATGCATGTGAAGGCTGCAAGGTAAGACAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1310
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103169 | Nonsense | 514 | 570 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 35847475)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 35697128 GRCz11 23 35795931 - KASP Assay ID:
- 554-1225.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATAAACACTTTTGTGTCTATCCACAGATTGCTCTGGCATTTCGGATATGT[T/A]GGCGGTTGAACAGCTCCAGGAAGGACTCATCCGAGCTCTGCGCACTTTAA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: