zgc:92862

Ensembl ID:
ENSDARG00000031153
ZFIN ID:
ZDB-GENE-040718-188
Description:
28S ribosomal protein S15, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6DGL8]
Human Orthologue:
MRPS15
Human Description:
mitochondrial ribosomal protein S15 [Source:HGNC Symbol;Acc:14504]
Mouse Orthologue:
Mrps15
Mouse Description:
mitochondrial ribosomal protein S15 Gene [Source:MGI Symbol;Acc:MGI:1913657]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24766 Nonsense Available for shipment Available now
sa45029 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128936 Nonsense 64 263 2 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3563 (position 252275)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36098148
GRCz11 16 36106797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGTTTCAGGTGATGAAACTCTCCTTAACCAACCAGTGAGGCAATA[T/A]GCTCGACCTTCTAGAAAGAAACAAGGTAAGAGAAGAATATTAGGGCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128936 Nonsense 217 263 7 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3563 (position 256625)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36093798
GRCz11 16 36102447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACATACACCTTCCCTCCTGAATACTACAGACGGGTCACTCGACGTTG[G/A]CTCGCCAAAAAGGCCTTCTGTAATAAGGTAAGTTCAGTTCACACTAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link