Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001155126.1
- Ensembl ID:
- ENSDARG00000031126
- Description:
- protein notum homolog [Source:RefSeq peptide;Acc:NP_001155126]
- Human Orthologue:
- NOTUM
- Human Description:
- notum pectinacetylesterase homolog (Drosophila) [Source:HGNC Symbol;Acc:27106]
- Mouse Orthologue:
- Notum
- Mouse Description:
- notum pectinacetylesterase homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924833]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa31363 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31363
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000047418 | Essential Splice Site | 183 | 500 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 58783580)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 57899168 GRCz11 3 57969692 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCTTCACTCCCAGAGGAAAACCCACACTGGTGGAACGCCAACATGGTG[T/A]GAGTATCCCAGAGCTAATGTTTGTGAAAATACATTCTTTACATCTTTTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
