veph

Ensembl ID:
ENSDARG00000031095
ZFIN ID:
ZDB-GENE-041014-375
Description:
Ventricular zone-expressed PH domain-containing protein [Source:UniProtKB/Swiss-Prot;Acc:A2BID5]
Human Orthologue:
VEPH1
Human Description:
ventricular zone expressed PH domain homolog 1 (zebrafish) [Source:HGNC Symbol;Acc:25735]
Mouse Orthologue:
Veph1
Mouse Description:
ventricular zone expressed PH domain homolog 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1920039]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44896 Nonsense Mutation detected in F1 DNA During 2018
sa36714 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048985 Nonsense 315 813 7 14
Genomic Location (Zv9):
Chromosome 18 (position 39755145)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41424642
GRCz11 18 41414834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCACAGATCCAGGCTCGTGGGGCTCTGCAGTATCTGGTGTCTCTGT[T/A]AGCGAGTATGGAGCACAGCGCTCATCACACACTGCTGCTGGAAATCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048985 Essential Splice Site 650 813 11 14
Genomic Location (Zv9):
Chromosome 18 (position 39772206)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41441703
GRCz11 18 41431895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACAGCTTTGAGCTGGCCATGACCCAGACCACTGTTCCTCACAAGAAG[G/A]TAAAGTCTTCTACTGTCTGCCAGTCACACAAACACACTCATACGAACCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link