gspt1

Ensembl ID:
ENSDARG00000031048
ZFIN ID:
ZDB-GENE-040822-36
Description:
G1 to S phase transition 1 [Source:RefSeq peptide;Acc:NP_001003992]
Human Orthologues:
GSPT1, GSPT2
Human Descriptions:
G1 to S phase transition 1 [Source:HGNC Symbol;Acc:4621]
G1 to S phase transition 2 [Source:HGNC Symbol;Acc:4622]
Mouse Orthologues:
Gspt1, Gspt2
Mouse Descriptions:
G1 to S phase transition 1 Gene [Source:MGI Symbol;Acc:MGI:1316728]
G1 to S phase transition 2 Gene [Source:MGI Symbol;Acc:MGI:1316727]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44759 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041711 Essential Splice Site 149 564 3 14
Genomic Location (Zv9):
Chromosome 12 (position 20465732)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19247576
GRCz11 12 19369450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCCCCCAAGAAAGAACACGTGAATGTTGTGTTCATTGGACATGTGGG[T/C]ATGTTAAATGTGCTTAGAGTGTTGGGATGTACTGCTAAACTGTTATATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link