
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nr1h5
- Ensembl ID:
- ENSDARG00000031046
- ZFIN ID:
- ZDB-GENE-080403-3
- Description:
- nuclear receptor subfamily 1, group H, member 5 [Source:RefSeq peptide;Acc:NP_001116713]
- Mouse Orthologue:
- Nr1h5
- Mouse Description:
- nuclear receptor subfamily 1, group H, member 5 Gene [Source:MGI Symbol;Acc:MGI:3026618]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15588 | Nonsense | Available for shipment | Available now |
sa21210 | Essential Splice Site, Missense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15588
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064040 | Nonsense | 113 | 490 | 2 | 10 |
ENSDART00000124313 | Nonsense | 113 | 486 | 3 | 11 |
The following transcripts of ENSDARG00000031046 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 11790564)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 10878560 GRCz11 8 10916265 - KASP Assay ID:
- 2260-0212.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGTCCAAAGCTCAACAGCCAGAGCCAGCATTGTTGGTCTTCCAGTGCTG[A/T]AAAGACCCAGAATGGGCYATGGAGCTCGAGTGAAGGGCCAGGATGAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21210
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064040 | Missense | 386 | 490 | 9 | 10 |
ENSDART00000124313 | Essential Splice Site | 378 | 486 | 10 | 11 |
The following transcripts of ENSDARG00000031046 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 11800703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 10868421 GRCz11 8 10906126 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTGACTTAATGTTTTGTTGTCTTTGCTTGTGCTTTATATCTTTGTTCA[G/A]GGTTGAATGATGAGCTCTTGAGATCTGTGGTAAATTTCCTTCATAGCATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: