zgc:56622

Ensembl ID:
ENSDARG00000031014
ZFIN ID:
ZDB-GENE-030131-4758
Description:
hypothetical protein LOC326033 [Source:RefSeq peptide;Acc:NP_956031]
Human Orthologues:
AKR1A1, AKR1B1, AKR1B10, AKR1B15, AKR1E2
Human Descriptions:
aldo-keto reductase family 1, member A1 (aldehyde reductase) [Source:HGNC Symbol;Acc:380]
aldo-keto reductase family 1, member B1 (aldose reductase) [Source:HGNC Symbol;Acc:381]
aldo-keto reductase family 1, member B10 (aldose reductase) [Source:HGNC Symbol;Acc:382]
aldo-keto reductase family 1, member B15 [Source:HGNC Symbol;Acc:37281]
aldo-keto reductase family 1, member E2 [Source:HGNC Symbol;Acc:23437]
Mouse Orthologues:
Akr1a4, Akr1b10, Akr1b3, Akr1b7, Akr1b8, Akr1e1, Gm6736
Mouse Descriptions:
aldo-keto reductase family 1, member A4 (aldehyde reductase) Gene [Source:MGI Symbol;Acc:MGI:1929955
aldo-keto reductase family 1, member B10 (aldose reductase) Gene [Source:MGI Symbol;Acc:MGI:1915111]
aldo-keto reductase family 1, member B3 (aldose reductase) Gene [Source:MGI Symbol;Acc:MGI:1353494]
aldo-keto reductase family 1, member B7 Gene [Source:MGI Symbol;Acc:MGI:101918]
aldo-keto reductase family 1, member B8 Gene [Source:MGI Symbol;Acc:MGI:107673]
aldo-keto reductase family 1, member E1 Gene [Source:MGI Symbol;Acc:MGI:1914758]
predicted gene 6736 Pseudogene [Source:MGI Symbol;Acc:MGI:3643048]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23251 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042775 Nonsense 112 289 4 10
Genomic Location (Zv9):
Chromosome 18 (position 12666366)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13220203
GRCz10 18 13222160
GRCz11 18 13188715
GRCz11 18 13190672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTTTTCCAGAGAGGGATGGAAAGATCCTCACAACTGACATAGACTA[T/A]GTGGATGTGTGGAGGGTAATGCTAACGCTAGCGCTAAAATTAAAAACTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Neonatal lupus: Identification of candidate loci at 6p21 and 21q22 in a genome-wide association study of cardiac manifestations of neonatal lupus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link