mybl1

Ensembl ID:
ENSDARG00000030999
ZFIN ID:
ZDB-GENE-041111-281
Human Orthologue:
MYBL1
Human Description:
v-myb myeloblastosis viral oncogene homolog (avian)-like 1 [Source:HGNC Symbol;Acc:7547]
Mouse Orthologue:
Mybl1
Mouse Description:
myeloblastosis oncogene-like 1 Gene [Source:MGI Symbol;Acc:MGI:99925]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45831 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066655 Splice Site, Nonsense 41 740 2 16
ENSDART00000146580 Splice Site, Nonsense 41 707 2 15
Genomic Location (Zv9):
Chromosome 24 (position 24402859)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23649737
GRCz11 24 23794911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAAGAATTCTAAAAGGACTCTGTGCAAAATTAAATGGTCCCGAGAT[G/T]AGGTATGCTTGTGTTTGTAATGTTTAGTTGGGGTTATACTTGGAAGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link