csrp1b

Ensembl ID:
ENSDARG00000030980
ZFIN ID:
ZDB-GENE-070112-252
Description:
cysteine and glycine-rich protein 1 [Source:RefSeq peptide;Acc:NP_001074083]
Human Orthologue:
CSRP1
Human Description:
cysteine and glycine-rich protein 1 [Source:HGNC Symbol;Acc:2469]
Mouse Orthologue:
Csrp1
Mouse Description:
cysteine and glycine-rich protein 1 Gene [Source:MGI Symbol;Acc:MGI:88549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44649 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048887 Nonsense 40 192 3 6
Genomic Location (Zv9):
Chromosome 6 (position 54816775)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54833315
GRCz11 6 54843128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATACTTACTAACTCTTTCTCTATGTCTGTTGAGCACAGTGGTGTGC[A/T]GAAAGAATCTGGACAGTACAACAGTAGCTGTGCATCAGGATGAGATCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link