
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-51a6.2
- Ensembl ID:
- ENSDARG00000030967
- ZFIN ID:
- ZDB-GENE-090313-118
- Description:
- Novel protein similar to vertebrate protease, serine, 12 (Neurotrypsin, motopsin) (PRSS12) [Source:U
- Human Orthologue:
- PRSS12
- Human Description:
- protease, serine, 12 (neurotrypsin, motopsin) [Source:HGNC Symbol;Acc:9477]
- Mouse Orthologue:
- Prss12
- Mouse Description:
- protease, serine, 12 neurotrypsin (motopsin) Gene [Source:MGI Symbol;Acc:MGI:1100881]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5858 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42181 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5858
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021556 | Essential Splice Site | 118 | 832 | 3 | 14 |
ENSDART00000140307 | None | 554 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 13 (position 21932350)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21661688 GRCz11 13 21792138 - KASP Assay ID:
- 554-3952.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGACAGAAGTCTGGAGCCRTCGGGTGGGCTTACTGTGACTGCCACCAGGG[T/C]GAGCTCTACTCAATGCCTTCTCTCATGCAGTCATATTTATGGTGGTTATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42181
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021556 | Nonsense | 257 | 832 | 6 | 14 |
ENSDART00000140307 | None | 554 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 13 (position 21941418)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21670756 GRCz11 13 21801206 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGTGTGGAGGTGTATTATAATGGACGGTGGGGGACCATCTGTGATGAC[G/T]AGTGGGATGATATTGATGCTGAAGTGGTTTGCAGACAGTTGGGATTGGGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: