zgc:92746

Ensembl ID:
ENSDARG00000030949
ZFIN ID:
ZDB-GENE-040718-311
Description:
signal recognition particle receptor subunit beta [Source:RefSeq peptide;Acc:NP_001002572]
Human Orthologue:
SRPRB
Human Description:
signal recognition particle receptor, B subunit [Source:HGNC Symbol;Acc:24085]
Mouse Orthologue:
Srprb
Mouse Description:
signal recognition particle receptor, B subunit Gene [Source:MGI Symbol;Acc:MGI:102964]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22575 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047013 Essential Splice Site 80 266 3 7
Genomic Location (Zv9):
Chromosome 15 (position 2506710)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2552068
GRCz11 15 2515640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAACACTATAATCATCAGACTGTCATTAAGATGCTGTGTGTTTTTCTA[G/A]TTATTACTAGGAAAGTTTGTACGAACTCAGACGTCCATCACAGAGAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link