zgc:64101

Ensembl ID:
ENSDARG00000030938
ZFIN ID:
ZDB-GENE-040426-1366
Description:
fermitin family homolog 3 [Source:RefSeq peptide;Acc:NP_957198]
Human Orthologue:
FERMT3
Human Description:
fermitin family member 3 [Source:HGNC Symbol;Acc:23151]
Mouse Orthologue:
Fermt3
Mouse Description:
fermitin family homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2147790]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17885 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047716 Essential Splice Site None 642 1 15
Genomic Location (Zv9):
Chromosome 14 (position 48905336)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46982995
GRCz11 14 45970287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTATTCAAATCAAGAGGACGGAGACACTMTCAGCAGAACTAAATAAGG[T/G]AAATATAATAAATGATCATTATTTGACTTACATTTTAGATACAATAAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link