zgc:152873

Ensembl ID:
ENSDARG00000030913
ZFIN ID:
ZDB-GENE-061103-457
Description:
Protein KIAA0664 homolog [Source:UniProtKB/Swiss-Prot;Acc:A0JMD0]
Human Orthologue:
KIAA0664
Human Description:
KIAA0664 [Source:HGNC Symbol;Acc:29094]
Mouse Orthologue:
1300001I01Rik
Mouse Description:
RIKEN cDNA 1300001I01 gene Gene [Source:MGI Symbol;Acc:MGI:1921398]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39047 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12848 Nonsense Available for shipment Available now
sa19117 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35891 Nonsense Mutation detected in F1 DNA During 2018
sa2783 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa39047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047471 Essential Splice Site 43 1400 1 26
ENSDART00000132239   None 971 None 17
Genomic Location (Zv9):
Chromosome 15 (position 24698027)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25431669
GRCz11 15 25366934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAACAGCAAAGGCACCACCAGTAAGAAGGAGGCGTCGTGTGCCTGCGG[T/C]ATGTCAGCTTTACACCGTTTCCACCTGCAGCATGTGCTTGGAAATCACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047471 Nonsense 283 1400 6 26
ENSDART00000132239   None 971 None 17
Genomic Location (Zv9):
Chromosome 15 (position 24685814)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25419456
GRCz11 15 25354721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGAACCCTCYGCCCGGCAACAGRAAAATGCACGGTGACCTCATGTA[T/A]CTGTACATYGTGACTGTTGAGGACAGACACGTCAGCATCACTGCCTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047471 Essential Splice Site 1101 1400 18 26
ENSDART00000132239 Essential Splice Site 672 971 9 17
Genomic Location (Zv9):
Chromosome 15 (position 24673984)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25407626
GRCz11 15 25342891
KASP Assay ID:
2260-8528.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGATGCCTTCCATTTCTTCCAGAGCGGACAGGCCAAGGTTCAGCAAG[G/A]TAACAAAAACAAATGATCATCGGTGCTTTGACACCTTCAACGTTTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047471 Nonsense 1253 1400 22 26
ENSDART00000132239 Nonsense 824 971 13 17
Genomic Location (Zv9):
Chromosome 15 (position 24666938)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25400580
GRCz11 15 25335845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGAGAACGCGCTGGCCATCAACACAAAATACCACGGGCCGCGATCCT[T/A]GAAAGTAGCCCTCAGGTAAATATGTATGACTGTACTCATACTCACTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2783
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047471 Nonsense 1383 1400 26 26
ENSDART00000132239 Nonsense 954 971 17 17
Genomic Location (Zv9):
Chromosome 15 (position 24654186)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25387828
GRCz11 15 25323093
KASP Assay ID:
554-2446.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGCTGAGGTACAGAGACGGCAGCTGATGCAGGATTCTGGGAAAATC[C/T]AGGAACAGCAGGGCAGTCATTTAGAGCTSGATGACAAGCTGCCTGTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link