zgc:154142

Ensembl ID:
ENSDARG00000030893
ZFIN ID:
ZDB-GENE-070615-2
Description:
hypothetical protein LOC555481 [Source:RefSeq peptide;Acc:NP_001092710]
Human Orthologue:
CELA1
Human Description:
chymotrypsin-like elastase family, member 1 [Source:HGNC Symbol;Acc:3308]
Mouse Orthologue:
Cela1
Mouse Description:
chymotrypsin-like elastase family, member 1 Gene [Source:MGI Symbol;Acc:MGI:95314]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19589 Nonsense Available for shipment Available now
sa25668 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064036 Nonsense 368 1090 8 20
ENSDART00000138224 Nonsense 368 846 8 16
Genomic Location (Zv9):
Chromosome 1 (position 51333641)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50180520
GRCz11 1 50824319
KASP Assay ID:
2259-1110.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCGCATCACCGATTTGGCCATCGTGGGTGAAGCGGGTCAATGCGGC[A/T]AAGATAAACTCACCGTCTCTGATAGTCTGCAGTCACTGGGTAAGACACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064036 Essential Splice Site 638 1090 13 20
ENSDART00000138224 Essential Splice Site 638 846 13 16
Genomic Location (Zv9):
Chromosome 1 (position 51319107)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50165986
GRCz11 1 50809785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTCATTCATAAGAACTGGGTTCTGACCGCTGCTCACTGCTTTATCAG[G/A]TGAAAGCAAACGATTCCAGTCTTTATATACACTGTGAACACTAAAACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link