zgc:101006

Ensembl ID:
ENSDARG00000030804
ZFIN ID:
ZDB-GENE-040801-119
Description:
constitutive coactivator of peroxisome proliferator-activated receptor gamma [Source:RefSeq peptide
Human Orthologue:
FAM120B
Human Description:
family with sequence similarity 120B [Source:HGNC Symbol;Acc:21109]
Mouse Orthologue:
Fam120b
Mouse Description:
family with sequence similarity 120, member B Gene [Source:MGI Symbol;Acc:MGI:1914794]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42133 Nonsense Mutation detected in F1 DNA During 2018
sa1425 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049328 Nonsense 167 537 2 7
Genomic Location (Zv9):
Chromosome 13 (position 5767024)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5961049
GRCz11 13 6089509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGACTTTCTGCTCGGTTCGTGAAGGAGATTACGAGGTCGCGGATTA[T/A]GCTCTGTCTCACAACTGCATGGGGATTCTCGGTCAGGATACAGATTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049328 Nonsense 380 537 3 7
Genomic Location (Zv9):
Chromosome 13 (position 5769614)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5963639
GRCz11 13 6092099
KASP Assay ID:
554-1346.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGGAGGACGAGGACGASATGGAGCTTCCACCACAGGCCATCTTATA[T/A]CTGCCCATSCGGGAACRAATATACGGCATTTTACTGCCAACGGAGCCAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link