zgc:110006

Ensembl ID:
ENSDARG00000030803
ZFIN ID:
ZDB-GENE-050522-119
Description:
Protein EURL homolog [Source:UniProtKB/Swiss-Prot;Acc:Q503Y8]
Human Orthologue:
C21orf91
Human Description:
chromosome 21 open reading frame 91 [Source:HGNC Symbol;Acc:16459]
Mouse Orthologue:
D16Ertd472e
Mouse Description:
DNA segment, Chr 16, ERATO Doi 472, expressed Gene [Source:MGI Symbol;Acc:MGI:1196400]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21778 Essential Splice Site Available for shipment Available now
sa31790 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049633 Essential Splice Site 223 277 5 5
ENSDART00000125529 Essential Splice Site 223 277 4 4
Genomic Location (Zv9):
Chromosome 10 (position 36083491)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35116193
GRCz11 10 35060053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTATTCAGTATTGAAGTTTGAAGCTGTTGAACTGTTGTGTGTCCCTCA[G/T]ATGTGTTCGAGGAGCTCTCTGTGGTCGTTCAGGAGAAAGACTCTCTCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049633 Nonsense 263 277 5 5
ENSDART00000125529 Nonsense 263 277 4 4
Genomic Location (Zv9):
Chromosome 10 (position 36083371)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35116073
GRCz11 10 35059933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCGCCATCGAGCAGCTCTTCAAAAACTGCGCCAAGCTGCCCTGGCTA[C/T]AGATAGGCAGAGCGGGCGTCAAAGCTGCAAACAACCCAGTGGAATAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link