
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:63733
- Ensembl ID:
- ENSDARG00000030790
- ZFIN ID:
- ZDB-GENE-040426-1249
- Description:
- UPF0668 protein C10orf76 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6PGW3]
- Human Orthologue:
- C10orf76
- Human Description:
- chromosome 10 open reading frame 76 [Source:HGNC Symbol;Acc:25788]
- Mouse Orthologue:
- 9130011E15Rik
- Mouse Description:
- RIKEN cDNA 9130011E15 gene Gene [Source:MGI Symbol;Acc:MGI:1918867]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11897 | Essential Splice Site | Available for shipment | Available now |
sa39384 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa37565 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11897
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045227 | Essential Splice Site | 161 | 656 | 7 | 26 |
ENSDART00000112889 | Essential Splice Site | 194 | 689 | 7 | 26 |
- Genomic Location (Zv9):
- Chromosome 22 (position 37888564)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 35073444 GRCz11 22 35049193 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATACTGGAGTATGTGATGATCAACAGTATATTTGAGGCCATCTTACAGG[T/A]AAAACTCTGATTTTNCCATTAAATCGTTTTTCTTATCTAAATGCTAATTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39384
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045227 | Essential Splice Site | 317 | 656 | 15 | 26 |
ENSDART00000112889 | Essential Splice Site | 350 | 689 | 15 | 26 |
- Genomic Location (Zv9):
- Chromosome 22 (position 37876601)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 35061481 GRCz11 22 35037230 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTTAAACTCAAAAGTATATACTTTCTTTCTTTGTTTCTTTTTTTCTGC[A/G]GTGATGAATAATCCTGAGCTTCCTCTGGACCCAAACTTGCAGACGAGTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37565
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045227 | Essential Splice Site | 416 | 656 | 18 | 26 |
ENSDART00000112889 | Essential Splice Site | 449 | 689 | 18 | 26 |
- Genomic Location (Zv9):
- Chromosome 22 (position 37871771)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 35056651 GRCz11 22 35032400 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGCAGATAAAAACATCCCCTGTCGGCCTTTAGTGTGTGCTGTGCTGGG[T/A]GAGTTGTGTCTAACATTTGTGAAAGACTTACTGTTATATGTATTTATTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: