zgc:63733

Ensembl ID:
ENSDARG00000030790
ZFIN ID:
ZDB-GENE-040426-1249
Description:
UPF0668 protein C10orf76 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6PGW3]
Human Orthologue:
C10orf76
Human Description:
chromosome 10 open reading frame 76 [Source:HGNC Symbol;Acc:25788]
Mouse Orthologue:
9130011E15Rik
Mouse Description:
RIKEN cDNA 9130011E15 gene Gene [Source:MGI Symbol;Acc:MGI:1918867]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11897 Essential Splice Site Available for shipment Available now
sa39384 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37565 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045227 Essential Splice Site 161 656 7 26
ENSDART00000112889 Essential Splice Site 194 689 7 26
Genomic Location (Zv9):
Chromosome 22 (position 37888564)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35073444
GRCz11 22 35049193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACTGGAGTATGTGATGATCAACAGTATATTTGAGGCCATCTTACAGG[T/A]AAAACTCTGATTTTNCCATTAAATCGTTTTTCTTATCTAAATGCTAATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045227 Essential Splice Site 317 656 15 26
ENSDART00000112889 Essential Splice Site 350 689 15 26
Genomic Location (Zv9):
Chromosome 22 (position 37876601)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35061481
GRCz11 22 35037230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTAAACTCAAAAGTATATACTTTCTTTCTTTGTTTCTTTTTTTCTGC[A/G]GTGATGAATAATCCTGAGCTTCCTCTGGACCCAAACTTGCAGACGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045227 Essential Splice Site 416 656 18 26
ENSDART00000112889 Essential Splice Site 449 689 18 26
Genomic Location (Zv9):
Chromosome 22 (position 37871771)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35056651
GRCz11 22 35032400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCAGATAAAAACATCCCCTGTCGGCCTTTAGTGTGTGCTGTGCTGGG[T/A]GAGTTGTGTCTAACATTTGTGAAAGACTTACTGTTATATGTATTTATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link