si:dkey-22f5.10

Ensembl ID:
ENSDARG00000030749
ZFIN ID:
ZDB-GENE-091204-81
Human Orthologue:
PHKA1
Human Description:
phosphorylase kinase, alpha 1 (muscle) [Source:HGNC Symbol;Acc:8925]
Mouse Orthologue:
Phka1
Mouse Description:
phosphorylase kinase alpha 1 Gene [Source:MGI Symbol;Acc:MGI:97576]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43674 Nonsense Mutation detected in F1 DNA During 2018
sa37345 Essential Splice Site Available for shipment Available now
sa43673 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31061 Essential Splice Site Mutation detected in F1 DNA During 2018
sa29628 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa23976 Nonsense Available for shipment Available now
sa23975 Essential Splice Site Available for shipment Available now
sa11407 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Nonsense 173 1230 5 35
ENSDART00000140003 Nonsense 173 1173 5 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29397911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30598162
GRCz11 21 30634857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATACTCGTGATGAAGTCGATGTTGTCCAGAATCTGATTTTTTACATC[G/T]AATCTGCATACAAAGTAGCGGTAAGCACCATTAAGCTGTTCTGATATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Essential Splice Site 206 1230 6 35
ENSDART00000140003 Essential Splice Site 206 1173 6 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29397730)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30597981
GRCz11 21 30634676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACAAAGGGATCCCTGAGATAAATGCCAGCTCTATCGGGATGGCAAAG[G/A]TAAAATGATTTCACATGTCTAACAAGTGTCAAATAATGATCTCTTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Essential Splice Site 207 1230 7 35
ENSDART00000140003 Essential Splice Site 207 1173 7 32
ENSDART00000048211 Essential Splice Site 207 1230 7 35
ENSDART00000140003 Essential Splice Site 207 1173 7 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29397645)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30597896
GRCz11 21 30634591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGATCTCTTCATGATACAATAACATGACCTCTCGCTGCATGTTTATTT[A/T]GGCAGCTTTGGAGGCCTTGGACGGACTGAACCTGTTTGGTGCCAAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Essential Splice Site 207 1230 7 35
ENSDART00000140003 Essential Splice Site 207 1173 7 32
ENSDART00000048211 Essential Splice Site 207 1230 7 35
ENSDART00000140003 Essential Splice Site 207 1173 7 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29397645)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30597896
GRCz11 21 30634591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGATCTCTTCATGATACAATAACATGACCTCTCGCTGCATGTTTATTT[A/T]GGCAGCTTTGGAGGCCTTGGACGGACTGAACCTGTTTGGTGCCAAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Missense 488 1230 15 35
ENSDART00000140003 Essential Splice Site 487 1173 15 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29388814)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30589065
GRCz11 21 30625760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGCATTTACAAACTGAACAAATTGTTGTCAATTTGTTTTTTTTTCA[G/T]GGCGAAACCAAAGGCTGGGACTGACTGGACGACCGTATAGGCGAATTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Nonsense 577 1230 17 35
ENSDART00000140003 Nonsense 576 1173 17 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29385342)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30585593
GRCz11 21 30622288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTCTGAGAGACTCATTTGGTTTTTGTCCTTTGCAGGCGATGATTAC[A/T]AACAAGTTAATCCTACGGTTTTGGCAACCCTCAAAAAATTACAAGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Essential Splice Site 738 1230 23 35
ENSDART00000140003 Essential Splice Site 701 1173 20 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29379865)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30580116
GRCz11 21 30616811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCATTCTCCGGCACCAGACCTTAATCTGCTGGTTGACAAAGAGAAG[G/A]TAGATAACATGAAATTAGCGGATTTTGCTGTGATTGTTGGAGTATTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048211 Essential Splice Site 892 1230 27 35
ENSDART00000140003 Essential Splice Site 854 1173 24 32

The following transcripts of ENSDARG00000030749 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29374849)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30575100
GRCz11 21 30611795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCGATGAKGCCAGTGAGAACAACCTCACCATCGCCATYCTCACTCAGG[T/C]TAGAGCTCAGGCCAGATCCACATCTCAGTCTTAWRTGTTTTAATTTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link