Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-246k9.1
- Ensembl ID:
- ENSDARG00000030743
- ZFIN IDs:
- ZDB-GENE-040801-81, ZDB-GENE-040801-81, ZDB-GENE-041210-281
- Description:
- hypothetical protein LOC445168 [Source:RefSeq peptide;Acc:NP_001003562]
- Human Orthologue:
- SPTLC3
- Human Description:
- serine palmitoyltransferase, long chain base subunit 3 [Source:HGNC Symbol;Acc:16253]
- Mouse Orthologue:
- Sptlc3
- Mouse Description:
- serine palmitoyltransferase, long chain base subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2444678]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa35545 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35545
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000047552 | Nonsense | 117 | 553 | 3 | 12 |
| ENSDART00000134573 | Nonsense | 117 | 204 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 13 (position 35076754)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 34729787 GRCz11 13 34855793 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTACAGGACTTTGTTCCCCTTTACCAAGATTTTGAAAACTTCTACAAA[C/T]GAAATCTGTACATGAGAGTCAGGGACAACTGGAATCGGCCCATATGCAGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Personality dimensions: Genome-wide association study of personality traits in bipolar patients. (View Study)
- Sphingolipid levels: Genetic determinants of circulating sphingolipid concentrations in European populations. (View Study)
- Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)
- Waist-to-hip circumference ratio (interaction): Gene-environment interactions and obesity traits among postmenopausal African-American and Hispanic women in the Women's Health Initiative SHARe Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
