znf326

Ensembl ID:
ENSDARG00000030737
ZFIN ID:
ZDB-GENE-070424-227
Description:
zinc finger protein 326 [Source:RefSeq peptide;Acc:NP_001076310]
Human Orthologue:
ZNF326
Human Description:
zinc finger protein 326 [Source:HGNC Symbol;Acc:14104]
Mouse Orthologue:
Zfp326
Mouse Description:
zinc finger protein 326 Gene [Source:MGI Symbol;Acc:MGI:1927246]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17266 Essential Splice Site Available for shipment Available now
sa31507 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039572 Essential Splice Site 154 451 None 13

The following transcripts of ENSDARG00000030737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 21374699)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25062309
GRCz11 6 25162118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGGCAGAGGTGCTGTCGTACATGAGGCCAAAGGACAAAGTGTAGGGG[T/A]ACGTCTGGGRAACATCTAAACAAACCCTGGAGTACAGGATTACTTTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039572 Essential Splice Site 209 451 5 13

The following transcripts of ENSDARG00000030737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 21374226)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25061836
GRCz11 6 25161645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAAAAAGAGGATAGTCAGAGCAGCTCCCAGTAAAAGCAACATAGTGG[G/T]TATGTGATCTGCGTCTTTGATTGACCTAGCTTAAGACCTTGATTTAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link