
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ctps
- Ensembl ID:
- ENSDARG00000030700
- ZFIN ID:
- ZDB-GENE-030131-808
- Description:
- CTP synthase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PEI7]
- Human Orthologue:
- CTPS
- Human Description:
- CTP synthase [Source:HGNC Symbol;Acc:2519]
- Mouse Orthologue:
- Ctps
- Mouse Description:
- cytidine 5'-triphosphate synthase Gene [Source:MGI Symbol;Acc:MGI:1858304]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7452 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7452
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017330 | Missense | 121 | 591 | 4 | 19 |
ENSDART00000129650 | Missense | 125 | 595 | 3 | 18 |
ENSDART00000131319 | Missense | 125 | 595 | 4 | 19 |
- Genomic Location (Zv9):
- Chromosome 19 (position 15451124)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 16114728 GRCz11 19 16019090 - KASP Assay ID:
- 554-4043.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAACTTGTTTATTCATTTGTTCCAGTGGTGCCACACATAACTGATGCTA[T/A]CCAGGAGTGGGTGATGCGTCAAGCCAAAATTCCTGTAGATGATGATGATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: