zgc:194455

Ensembl ID:
ENSDARG00000030641
ZFIN ID:
ZDB-GENE-080723-8
Description:
LETM1 domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001124088]
Human Orthologue:
LETMD1
Human Description:
LETM1 domain containing 1 [Source:HGNC Symbol;Acc:24241]
Mouse Orthologue:
Letmd1
Mouse Description:
LETM1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915864]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24379 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044658 Nonsense 72 362 2 9
ENSDART00000133688   None 178 None 4

The following transcripts of ENSDARG00000030641 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 32335417)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32170307
GRCz11 23 32096838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTGGTCGAAGCGTTGTGTCGAGTCTAAAGTGGGCCAATGAGAAGTA[C/A]GAGAGATTCCTGCAGCGGCGCTTCCCTCGCTTTTTTGTCCTCTATCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link