zgc:110191

Ensembl ID:
ENSDARG00000030632
ZFIN ID:
ZDB-GENE-050522-184
Description:
hypothetical protein LOC553593 [Source:RefSeq peptide;Acc:NP_001018406]
Human Orthologue:
CCDC3
Human Description:
coiled-coil domain containing 3 [Source:HGNC Symbol;Acc:23813]
Mouse Orthologue:
Ccdc3
Mouse Description:
coiled-coil domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1921436]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14321 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042221 Nonsense 100 271 1 3
Genomic Location (Zv9):
Chromosome 11 (position 4237348)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 4155852
GRCz11 11 4175239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGGAGGTGCCCGCCGGATCCAGGTTCAACGTCAGCGGGCTGGGGTA[T/A]TTCCCCTGCTACTCATACAGCGTCATGGAGAATAACTCCTACTATTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link