zgc:109962

Ensembl ID:
ENSDARG00000030626
ZFIN ID:
ZDB-GENE-050522-160
Description:
Leucine-rich repeat, immunoglobulin-like domain and transmembrane domain-containing protein 2 [Sourc
Human Orthologue:
LRIT2
Human Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2 [Source:HGNC Symbol;Acc:23443]
Mouse Orthologue:
Lrit2
Mouse Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42218 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028417 Nonsense 541 561 3 3
Genomic Location (Zv9):
Chromosome 13 (position 29697456)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29343404
GRCz11 13 29473854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTGATGAAGGTCTCTATAAAGAATCCAACAAAGACAAGAAAGCCAGA[C/T]GAAGGTCTGCGGAGAAGATACACAAGACAAAGAATGACCGAAGACCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link