
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rhogd
- Ensembl ID:
- ENSDARG00000030608
- ZFIN ID:
- ZDB-GENE-040426-1504
- Description:
- ras homolog gene family, member Ga [Source:RefSeq peptide;Acc:NP_956974]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13234 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13234
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049136 | Nonsense | 23 | 191 | 1 | 1 |
ENSDART00000129953 | Nonsense | 23 | 191 | 2 | 2 |
ENSDART00000146521 | Nonsense | 23 | 191 | 2 | 2 |
The following transcripts of ENSDARG00000030608 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 14 (position 12431177)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 11866950 GRCz11 14 12172964 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGGTGGTGGGAGACGGTGCGGTAGGCAAGACATGCCTTCTTATTTCTTA[T/A]ACGACAAATGCCTTTCCAGAGGAGTACATTCCCACAGTGTTTRACAACTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: