zgc:77880

Ensembl ID:
ENSDARG00000030563
ZFIN ID:
ZDB-GENE-040426-1901
Description:
hypothetical protein LOC393865 [Source:RefSeq peptide;Acc:NP_957185]
Human Orthologues:
ZDHHC3, ZDHHC7
Human Descriptions:
zinc finger, DHHC-type containing 3 [Source:HGNC Symbol;Acc:18470]
zinc finger, DHHC-type containing 7 [Source:HGNC Symbol;Acc:18459]
Mouse Orthologues:
Zdhhc3, Zdhhc7
Mouse Descriptions:
zinc finger, DHHC domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1926134]
zinc finger, DHHC domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2142662]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14751 Nonsense Available for shipment Available now
sa32600 Essential Splice Site Available for shipment Available now
sa17658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043881 Nonsense 6 297 1 9
Genomic Location (Zv9):
Chromosome 1 (position 9481778)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9621564
GRCz11 1 10305675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGACGTCATCARGAAGACCGCAGATGGGAAGATGGCTGCGTTTCGCTG[T/A]CGGCGAGACCCGTGCGGCTTTATTTGTCTYATTTTAACTTACTTCAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043881 Essential Splice Site 195 297 6 9
Genomic Location (Zv9):
Chromosome 1 (position 9487707)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9627493
GRCz11 1 10311604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGAAGAGAAAGAAGGAGAAGAAGCTCCCAGCAAACATCTCATTGTG[T/C]AAGTACAATTTCTTTCTGAGAAACTGTATTAATGTTATATAATGGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043881 Nonsense 272 297 9 9
Genomic Location (Zv9):
Chromosome 1 (position 9490459)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9630245
GRCz11 1 10314356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATAATRCTAAATGTATTTCTCTCACCTGTCTACAGGYTCTATAYTGTG[T/A]TGGTTATTCCCGCTTCATTCCACCCCTCCTTCTGTTGGCGGCATCAGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link