zgc:77407

Ensembl ID:
ENSDARG00000030560
ZFIN IDs:
ZDB-GENE-040426-2419, ZDB-GENE-040426-2419
Description:
Probable helicase with zinc finger domain [Source:UniProtKB/Swiss-Prot;Acc:Q6NYU2]
Human Orthologue:
HELZ
Human Description:
helicase with zinc finger [Source:HGNC Symbol;Acc:16878]
Mouse Orthologue:
Helz
Mouse Description:
helicase with zinc finger domain Gene [Source:MGI Symbol;Acc:MGI:1925705]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17927 Essential Splice Site Available for shipment Available now
sa14608 Essential Splice Site Available for shipment Available now
sa1241 Essential Splice Site F2 line generated During 2018
sa15507 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042674 Essential Splice Site 242 1860 7 30
ENSDART00000044096 Essential Splice Site 242 1860 8 31
ENSDART00000042674 Essential Splice Site 242 1860 7 30
ENSDART00000044096 Essential Splice Site 242 1860 8 31
Genomic Location (Zv9):
Chromosome 3 (position 61677766)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60742474
GRCz11 3 60975062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGCGCTCATCGAGAAGTGGATCAACTCACTCAYGCCCGAAAGAGTGG[T/C]AMAGTACAGTCCTWATCCCCACATATTATATAAGAGCWATGTCACATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042674 Essential Splice Site 242 1860 7 30
ENSDART00000044096 Essential Splice Site 242 1860 8 31
ENSDART00000042674 Essential Splice Site 242 1860 7 30
ENSDART00000044096 Essential Splice Site 242 1860 8 31
Genomic Location (Zv9):
Chromosome 3 (position 61677766)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60742474
GRCz11 3 60975062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGCGCTCATCGAGAAGTGGATCAACTCACTCAYGCCCGAAAGAGTGG[T/C]AMAGTACAGTCCTWATCCCCACATATTATATAAGAGCWATGTCACATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1241
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042674 Essential Splice Site 625 1860 12 30
ENSDART00000044096 Essential Splice Site 625 1860 13 31
Genomic Location (Zv9):
Chromosome 3 (position 61669271)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60750969
GRCz11 3 60983557
KASP Assay ID:
554-1156.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCCAGACATCAGCCTCACTCCCACAATCCCCTGGAGTCCCAACAGG[T/C]ACCACTGCGCACACAGATGCACATSAGTGACTGCACAGAGAGACTCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042674 Essential Splice Site 978 1860 19 30
ENSDART00000044096 Essential Splice Site 978 1860 20 31
Genomic Location (Zv9):
Chromosome 3 (position 61651978)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60768262
GRCz11 3 61000850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGAGGATGTCGGAGGTCAGCGTGGAGAGAGTGCTCAACGTGCAGGG[T/C]GAGTCCAGCACACTGCAGGAAAAAACATGCTGTTCTTATTGAGTTTCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link