zgc:64076

Ensembl ID:
ENSDARG00000030530
ZFIN ID:
ZDB-GENE-040426-2167
Description:
solute carrier family 22 member 2 [Source:RefSeq peptide;Acc:NP_998315]
Human Orthologues:
SLC22A1, SLC22A2
Human Descriptions:
solute carrier family 22 (organic cation transporter), member 1 [Source:HGNC Symbol;Acc:10963]
solute carrier family 22 (organic cation transporter), member 2 [Source:HGNC Symbol;Acc:10966]
Mouse Orthologues:
Slc22a1, Slc22a2
Mouse Descriptions:
solute carrier family 22 (organic cation transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1081
solute carrier family 22 (organic cation transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1335

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37131 Nonsense Mutation detected in F1 DNA During 2018
sa43516 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048890 Nonsense 49 562 1 11
Genomic Location (Zv9):
Chromosome 20 (position 42700784)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42771943
GRCz11 20 42669053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCGTCTATGTGGGGATTGTGTTTCAGGGATTTACTCCTGAGCATTG[G/A]TGCCGTGACCCAGCTGTCAGTGAGATTCGGGAAAGATGCGGATGGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048890 Nonsense 223 562 3 11
Genomic Location (Zv9):
Chromosome 20 (position 42708593)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42779752
GRCz11 20 42676862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGCTCTCTTTGGCTTTGGGGTGAAGGGCGGTTGGATGGTTGGATA[T/A]GTGCTAAGTACAAAAACATTTTAAAATAAACAAATTTTATTTTAAAGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link