zgc:162756

Ensembl ID:
ENSDARG00000030512
ZFIN ID:
ZDB-GENE-070424-39
Description:
translin-associated factor X-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001093570]
Human Orthologue:
TSNAXIP1
Human Description:
translin-associated factor X interacting protein 1 [Source:HGNC Symbol;Acc:18586]
Mouse Orthologue:
Tsnaxip1
Mouse Description:
translin-associated factor X (Tsnax) interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1919486]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11452 Nonsense Available for shipment Available now
sa15477 Nonsense Available for shipment Available now
sa17810 Essential Splice Site Available for shipment Available now
sa17203 Nonsense Available for shipment Available now
sa36649 Nonsense Mutation detected in F1 DNA During 2018
sa36648 Essential Splice Site Available for shipment Available now
sa5909 Nonsense Mutation detected in F1 DNA During 2018
sa23300 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Nonsense 30 673 2 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21729982)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21960205
GRCz11 18 21949271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTAGGTCATCGTCTCAATTTGAGTCTAATGATGACAACAATAGAGRAT[T/A]ACAGCGACACATTGCAAACAAGATGTCTAGAGCAAAATTGATAAAAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Nonsense 84 673 4 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21727962)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21958185
GRCz11 18 21947251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTATCTWCATGTCCTGCAGGTCTCTTGCCAAGCCTCGTTTCTYAGAG[C/T]AACTGGAGTGTCTTCTCAAGAGAGAACTAGAAGYTTTAGACAACACACAS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Essential Splice Site 207 673 None 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21726175)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21956398
GRCz11 18 21945464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGTCATTGAAAGCATGAGGTCACAACAGAGTGCTCTGCAGATTCAGG[T/C]GGAGCTCAGTTTACTTTRAWTTATTTTACTCTGTNNNNNNNNTYTTCTGTAGAGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Nonsense 229 673 7 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21725123)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21955346
GRCz11 18 21944412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGASGAWCTAGCCACCCAGTATCAGCTCTACAGGGACGAACGTGATGCA[C/T]GAAAGCTGCTCATCACYAGAATMAGCAYAATGCAATCTACCCAAGATGCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Nonsense 269 673 8 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21723938)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21954161
GRCz11 18 21943227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATGAGTCTGAGGATCCTGTGGTGGTGAAAATGGCTTTACAGGTGTG[T/A]CGAGAAGATCTTACCAAAGCCCAGATTGAACTCAACCGCCTTCAAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Essential Splice Site 442 673 12 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21721757)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21951980
GRCz11 18 21941046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGGTAATAAAAGAAATATGGAGAAACAAAATGGCGGATAATGAAAAG[G/A]TATGGTATACGAATGTTCTTTCTTAATTTGATTTATCGTTCGATAGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Nonsense 470 673 13 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21721586)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21951809
GRCz11 18 21940875
KASP Assay ID:
554-3646.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCTATCTTGTGGAACAGTATAAAGATAAAGCAGGAGAATGGGCTTA[C/A]AGCCTCATGGAAAGCGTACAAAACAATCTCAAAGATGATCTCATTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043452 Essential Splice Site 573 673 15 17

The following transcripts of ENSDARG00000030512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21716632)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21946855
GRCz11 18 21935921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGAGCAGTGGAGTGCGCATTTCTTATCAGACACTTTATACAGAG[G/A]TCAGTTCCAAAGTTTTCGCTAAGAATATGTAATTCTTTGATTGTAAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link