sptb

Ensembl ID:
ENSDARG00000030490
ZFIN ID:
ZDB-GENE-000906-1
Description:
spectrin beta chain, erythrocyte [Source:RefSeq peptide;Acc:NP_571600]
Human Orthologue:
SPTB
Human Description:
spectrin, beta, erythrocytic [Source:HGNC Symbol;Acc:11274]
Mouse Orthologue:
Spnb1
Mouse Description:
spectrin beta 1 Gene [Source:MGI Symbol;Acc:MGI:98387]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42981 Nonsense Mutation detected in F1 DNA During 2018
sa32168 Nonsense Available for shipment Available now
sa12908 Nonsense Available for shipment Available now
sa13819 Nonsense Available for shipment Available now
sa17671 Nonsense Available for shipment Available now
sa36485 Nonsense Mutation detected in F1 DNA During 2018
sa23143 Nonsense Available for shipment Available now
sa1326 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 49 2357 1 36
ENSDART00000145147 Nonsense 49 2357 1 36
Genomic Location (Zv9):
Chromosome 17 (position 38741166)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38626063
GRCz11 17 38573648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTGACAATGACAACAGCTCAGCCAGACTCTTTGAGCGCTCACGCATT[A/T]AAGCTCTTGCAGGTGAGTCGCCTCAAGTTACATCAAACTGAGCACATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 787 2357 13 36
ENSDART00000145147 Nonsense 787 2357 13 36
Genomic Location (Zv9):
Chromosome 17 (position 38755646)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38640543
GRCz11 17 38588128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGAGACAGATGAGCAGTGACGATGTTGGGCATGATGAGTACACTACA[C/T]AGCGACTGCTCAAGAAACACCGTGACTTAAGAGATGAGGCTGCTAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 799 2357 13 36
ENSDART00000145147 Nonsense 799 2357 13 36
Genomic Location (Zv9):
Chromosome 17 (position 38755682)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38640579
GRCz11 17 38588164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AHGAGTACACTACACAGCGACTGCTCAAGAAACACCGTGACTTAAGAGAT[G/T]AGGCTGCTAAGAATGGAGCCACCATTGATGCTCTATCCAAACAGGCCAAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 929 2357 14 36
ENSDART00000145147 Nonsense 929 2357 14 36
Genomic Location (Zv9):
Chromosome 17 (position 38756158)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38641055
GRCz11 17 38588640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATAACGTTAATAAAGCAGCCAAGCAACTYGAAGACAGCAGACATCCA[C/T]AAACAAAACAAGTGAAAGACTGTCAAATTCGTCTCAATAAGAGGTAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 1101 2357 15 36
ENSDART00000145147 Nonsense 1101 2357 15 36
Genomic Location (Zv9):
Chromosome 17 (position 38756758)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38641655
GRCz11 17 38589240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTCAAGTCACAGAAGGCTGTTGCTTCTGAAGATATGCCAGATGGTT[T/A]ACCAGAGGCTGAGCAACTCCTGAATCTCCATRATGCTTTGAGGCATGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 1444 2357 20 36
ENSDART00000145147 Nonsense 1444 2357 20 36
Genomic Location (Zv9):
Chromosome 17 (position 38759345)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38644242
GRCz11 17 38591827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTCTATTCCTCCCTAGATAACAGAGAATCAGGTTCGGGACCGTGCA[C/T]GAGAGCTTGAAGAACTTCAGGAGGCTGTAGAGCAGCATGGTTCTCTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 1510 2357 21 36
ENSDART00000145147 Nonsense 1510 2357 21 36
Genomic Location (Zv9):
Chromosome 17 (position 38759629)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38644526
GRCz11 17 38592111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCATATAGTTTTAATGAATGATTTTCTTGATTTTCTCCTCAGCTCT[G/A]GGTTAATGAAAGGTTACCAATGGCTATGTCAGATGATCATGGTAACAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040627 Nonsense 1917 2357 27 36
ENSDART00000145147 Nonsense 1917 2357 27 36
Genomic Location (Zv9):
Chromosome 17 (position 38763326)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38648223
GRCz11 17 38595808
KASP Assay ID:
554-1240.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTGAGGCCTGGAAGGGTCTGTTGGATGCTTGTGCGGGTAGGAGGAAA[C/T]AGCTGGAGGAGACAGCAGACAAATTCCGCTTTTTCACCATGGTGAGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link