zgc:165618

Ensembl ID:
ENSDARG00000030479
ZFIN ID:
ZDB-GENE-030131-8480
Description:
hypothetical protein LOC795095 [Source:RefSeq peptide;Acc:NP_001092721]
Human Orthologue:
HMGB1
Human Description:
high-mobility group box 1 [Source:HGNC Symbol;Acc:4983]
Mouse Orthologues:
AC166253.1, Gm5518, Hmgb1
Mouse Descriptions:
high mobility group box 1 Gene [Source:MGI Symbol;Acc:MGI:96113]
predicted gene 5176 (Gm5176), non-coding RNA [Source:RefSeq DNA;Acc:NR_033603]
predicted gene 5518 Pseudogene [Source:MGI Symbol;Acc:MGI:3648673]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44825 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108983 Nonsense 111 165 4 5
Genomic Location (Zv9):
Chromosome 15 (position 30811316)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31633023
GRCz11 15 31513764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTTGGAGAAATGTGGAACAGCTCATCAGCTGAAGTGAAGCAGCCCTA[T/A]GAAAAGAAAGCCGCAAAGCTCAAGGAGAAGTACGACAAGGTAAAGCAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link