zgc:66484

Ensembl ID:
ENSDARG00000030478
ZFIN ID:
ZDB-GENE-030131-5768
Description:
hypothetical protein LOC327557 [Source:RefSeq peptide;Acc:NP_956121]
Human Orthologues:
PAOX, SMOX
Human Descriptions:
polyamine oxidase (exo-N4-amino) [Source:HGNC Symbol;Acc:20837]
spermine oxidase [Source:HGNC Symbol;Acc:15862]
Mouse Orthologues:
Paox, Smox
Mouse Descriptions:
polyamine oxidase (exo-N4-amino) Gene [Source:MGI Symbol;Acc:MGI:1916983]
spermine oxidase Gene [Source:MGI Symbol;Acc:MGI:2445356]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34757 Nonsense Mutation detected in F1 DNA During 2018
sa17098 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044880 Nonsense 314 406 3 4
ENSDART00000131252   None 237 None 2
ENSDART00000138316 Nonsense 403 495 3 4
Genomic Location (Zv9):
Chromosome 9 (position 45969010)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45100675
GRCz11 9 44901627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATATCTCTATATGTATTTTTAAAGGTTGCTCAGGTCTTCAACAGGCT[G/A]GCCAGTACCAGAAGTGTCAAAGACGCTGATCTCCAGATGGGGCTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044880 Nonsense 395 406 4 4
ENSDART00000131252   None 237 None 2
ENSDART00000138316 Nonsense 484 495 4 4
Genomic Location (Zv9):
Chromosome 9 (position 45967253)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45098918
GRCz11 9 44899870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATGTGAACTTCTACACCACCACCCATGGAGCCTATTTATCCGGACAG[C/T]GAGAAGCAGAAAGACTCAWCAGCTATTACTCTGACTGAACATACAGTCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Panic disorder: Genome-wide association study of panic disorder in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link