tppp3

Ensembl ID:
ENSDARG00000030463
ZFIN ID:
ZDB-GENE-040426-1909
Description:
tubulin polymerization-promoting protein family member 3 [Source:RefSeq peptide;Acc:NP_958492]
Human Orthologue:
TPPP3
Human Description:
tubulin polymerization-promoting protein family member 3 [Source:HGNC Symbol;Acc:24162]
Mouse Orthologue:
Tppp3
Mouse Description:
tubulin polymerization-promoting protein family member 3 Gene [Source:MGI Symbol;Acc:MGI:1915221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40948 Missense, Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047644 Missense 91 177 2 3
ENSDART00000100260 Missense, Splice Site 91 101 3 5
ENSDART00000144327 Missense 91 177 3 4
Genomic Location (Zv9):
Chromosome 7 (position 36694378)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34968221
GRCz11 7 35239698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGAAAGCTCTAGAAGAATTGGCCCCAAAGAGGTTCAAAGGTCAAAG[C/A]AAAGAAGAAGCACTGGAGTCGATATATAAGCTAATTGAGGGCAAAGAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link