
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
angpt1
- Ensembl ID:
- ENSDARG00000030364
- ZFIN ID:
- ZDB-GENE-010817-1
- Description:
- angiopoietin-1 [Source:RefSeq peptide;Acc:NP_571888]
- Human Orthologue:
- ANGPT1
- Human Description:
- angiopoietin 1 [Source:HGNC Symbol;Acc:484]
- Mouse Orthologue:
- Angpt1
- Mouse Description:
- angiopoietin 1 Gene [Source:MGI Symbol;Acc:MGI:108448]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30714 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14264 | Nonsense | Available for shipment | Available now |
sa43349 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30714
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043713 | Nonsense | 2 | 513 | 1 | 9 |
- Genomic Location (Zv9):
- Chromosome 19 (position 48862631)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 47366239 GRCz11 19 46957835 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTCTTGATATATTTGTGAGTTTTCCGTCCCATCGGGCTCCTGCCATGTG[G/A]TGGGGTTGCTTGTTTCTGGCAGCGCTGCTGGTGGTTGCAGATTGTGGAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14264
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043713 | Nonsense | 261 | 513 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 19 (position 48775705)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 47279313 GRCz11 19 46870909 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAGAATCAGCTGAGCAGAGCTACCGGAAACAGCACAGCACTTCAGAGA[C/T]AGCAGCAGGACCTGAYGGAGAGCATGCGCAGCCTCCTCAGCCTCTGTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43349
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043713 | Essential Splice Site | 326 | 513 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 19 (position 48762659)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 47266267 GRCz11 19 46857863 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAAAACGGAGTTTACACCATCAATATTAGCCCACAAGAGACCAAAAAGG[T/C]AAATTATTCAATAAATCTTTGTTGAAACAAAGGTAAAGGGGAGACTCAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: