zgc:66313

Ensembl ID:
ENSDARG00000030357
ZFIN ID:
ZDB-GENE-040426-1606
Description:
hypothetical protein LOC393400 [Source:RefSeq peptide;Acc:NP_956722]
Human Orthologues:
AMY1A, AMY1B, AMY1C, AMY2A, AMY2B
Human Descriptions:
amylase, alpha 1A (salivary) [Source:HGNC Symbol;Acc:474]
amylase, alpha 1B (salivary) [Source:HGNC Symbol;Acc:475]
amylase, alpha 1C (salivary) [Source:HGNC Symbol;Acc:476]
amylase, alpha 2A (pancreatic) [Source:HGNC Symbol;Acc:477]
amylase, alpha 2B (pancreatic) [Source:HGNC Symbol;Acc:478]
Mouse Orthologues:
Amy1, Amy2a1, Amy2a2, Amy2a3, Amy2a4, Amy2a5
Mouse Descriptions:
amylase 1, salivary Gene [Source:MGI Symbol;Acc:MGI:88019]
amylase 2a1 Gene [Source:MGI Symbol;Acc:MGI:104548]
amylase 2a2 Gene [Source:MGI Symbol;Acc:MGI:3711220]
amylase 2a3 Gene [Source:MGI Symbol;Acc:MGI:3714985]
amylase 2a4 Gene [Source:MGI Symbol;Acc:MGI:3711258]
amylase 2a5 Gene [Source:MGI Symbol;Acc:MGI:88020]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10462 Nonsense Available for shipment Available now
sa28917 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042681 Nonsense 22 512 1 10
ENSDART00000132673 Nonsense 22 259 2 6
ENSDART00000133317 Nonsense 27 253 4 8
ENSDART00000133874 Nonsense 22 278 2 6
ENSDART00000134272 Nonsense 27 517 1 10
ENSDART00000140316 Nonsense 27 259 3 7
ENSDART00000142929 Nonsense 22 37 4 4
ENSDART00000148090 Nonsense 27 87 3 4

The following transcripts of ENSDARG00000030357 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 43915076)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43754754
GRCz11 17 43868519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGCTGCTCTYGTAGGACTGTGTCTTTCCCAGCACAACACTAACTTT[A/T]AACAWAACCGGACSTCCATCGTTCATCTGTTTGARTGGCGTTGGGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042681 Nonsense 348 512 7 10
ENSDART00000132673   None 259 None 6
ENSDART00000133317   None 253 None 8
ENSDART00000133874   None 278 None 6
ENSDART00000134272 Nonsense 353 517 7 10
ENSDART00000140316   None 259 None 7
ENSDART00000142929   None 37 None 4
ENSDART00000148090   None 87 None 4

The following transcripts of ENSDARG00000030357 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 43925897)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43765575
GRCz11 17 43879340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTAGGCTTTATAAGATCGCGACAGGACTTATGTTGGCTCATCCATA[C/A]GGTGTAACAGCAGTCATGTCCAGCTACCGATGGGATCGACATTTTGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link