zc3h10

Ensembl ID:
ENSDARG00000030335
ZFIN ID:
ZDB-GENE-040426-2359
Description:
zinc finger CCCH domain-containing protein 10 [Source:RefSeq peptide;Acc:NP_996981]
Human Orthologue:
ZC3H10
Human Description:
zinc finger CCCH-type containing 10 [Source:HGNC Symbol;Acc:25893]
Mouse Orthologue:
Zc3h10
Mouse Description:
zinc finger CCCH type containing 10 Gene [Source:MGI Symbol;Acc:MGI:2143670]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20821 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041549 Nonsense 263 541 2 3
Genomic Location (Zv9):
Chromosome 6 (position 52199599)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52248781
GRCz11 6 52248780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGGGATGGGGTGTCCCAGTCTGGGAGGATGCAGAGAACAAGGTCTGT[C/A]GGGTGGAGTAGGCGGTGGAGGTTCATTGAGCGGCTGTTTGTCAATTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link