si:dkey-229d2.2

Ensembl ID:
ENSDARG00000030311
ZFIN ID:
ZDB-GENE-060526-262
Description:
Novel protein similar to vertebrate transmembrane channel family [Source:UniProtKB/TrEMBL;Acc:A2BFV4
Human Orthologue:
TMC2
Human Description:
transmembrane channel-like 2 [Source:HGNC Symbol;Acc:16527]
Mouse Orthologue:
Tmc2
Mouse Description:
transmembrane channel-like gene family 2 Gene [Source:MGI Symbol;Acc:MGI:2151017]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8817 Nonsense Mutation detected in F1 DNA During 2018
sa38469 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044471 Nonsense 147 865 4 19
ENSDART00000141924 Nonsense 67 786 2 17
Genomic Location (Zv9):
Chromosome 5 (position 27281300)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25036598
GRCz11 5 25636751
KASP Assay ID:
2259-5813.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGAAGCACAGGAGTTTGTGGAGAAGTTTGAAGGAGCTTTRRGCAAA[G/T]GAAAAGGGAGGAGACTGTATGCATTTAAAGTCATGATGACCAAGGTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044471 Essential Splice Site 354 865 9 19
ENSDART00000141924 Essential Splice Site 274 786 7 17
Genomic Location (Zv9):
Chromosome 5 (position 27280228)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25035526
GRCz11 5 25635679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAGAGACAGCCGACAACAAGTTTGCCTCCACCACCACAAGCTTCAAG[G/A]TTAATAGCGATGATGAAAGAAAATGTGAAGATAAACTGATCAAATCAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link