
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tnnt3a
- Ensembl ID:
- ENSDARG00000030270
- ZFIN ID:
- ZDB-GENE-000322-3
- Description:
- troponin T3a, skeletal, fast [Source:RefSeq peptide;Acc:NP_571640]
- Human Orthologue:
- TNNT3
- Human Description:
- troponin T type 3 (skeletal, fast) [Source:HGNC Symbol;Acc:11950]
- Mouse Orthologue:
- Tnnt3
- Mouse Description:
- troponin T3, skeletal, fast Gene [Source:MGI Symbol;Acc:MGI:109550]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24709 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24709
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103395 | Nonsense | 177 | 230 | 10 | 12 |
ENSDART00000125901 | Nonsense | 229 | 282 | 10 | 12 |
The following transcripts of ENSDARG00000030270 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 25 (position 32260155)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 30839408 GRCz11 25 31416884 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTAAACTATCAGGAAAGGTCTTATGTCTTTGTGTCATCAACTTCAGGGAC[A/T]AAGCACAAGAGTTGTACGAGTGGATAAAGACTCTGGAATCTGAGAAATTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: