vbp1

Ensembl ID:
ENSDARG00000030241
ZFIN ID:
ZDB-GENE-050522-494
Description:
prefoldin subunit 3 [Source:RefSeq peptide;Acc:NP_001018460]
Human Orthologue:
VBP1
Human Description:
von Hippel-Lindau binding protein 1 [Source:HGNC Symbol;Acc:12662]
Mouse Orthologue:
Vbp1
Mouse Description:
von Hippel-Lindau binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1333804]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34056 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053030 Nonsense 4 102 1 2
ENSDART00000123203 Splice Site None 236 None 6
Genomic Location (Zv9):
Chromosome 7 (position 25057133)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23618885
GRCz11 7 23890042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGCTTGACTTTGAAATCTTGTGTATAGCCATGGTTGGTGTTTTTGTG[T/A]GCTAGGCTAATGTCATGTTGGAGTATGACATTGATGCGGCCCAGGCGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link